Search by sncRNA name/ID
Enter small RNA name:
Example small RNA
Search by HGNC symbol, RefSeq ID, UCSC ID, small RNA name, or gene name.
Search examples:
Search examples:
- primary miRNA search:MIR192, hsa-mir-192, NR_029578, uc058dbg.1
- mature miRNA 3p/5p search: hsa-miR-192-3p, hsa-miR-192-5p
- snoRNA/snRNA search: mgU6-53, SNORD8, NR_002916, uc001wau.2
- scRNA search: HY4, RNY4
- piRNA search: piR-36025
- tRNA search: tRNA-Pro-AGG-1-1
- tRF 3p/5p search: tRNA-Pro-AGG-1-1-tRF3, tRNA-Pro-AGG-1-1-tRF5
Search by genomic coordinates
Enter genomic coordinates:
Example genomic coordinates
Search examples: chr1:1103243-1103332, chr1 1103243 1103332
Note: If multiple loci are returned (common among duplicated RNAs such as tRNAs), we will display all annotated sncRNAs of any classes within those particular genomic coordinates on both strands.
View genomic region
Enter genomic coordinates:
Example genomic coordinatesSearch by sequence
Enter small RNA sequence:
Example sequence
Search examples: CAUCUUACUGGGCAGCAUUGGA, or with wildcard CAU_UUACUGGGCA_CAUUGGA
Note: Any sequence that contains the provided nucleotide sequence will be displayed.